Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4253 precursor URS000075A710_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4253: Hsa-mir-4253 is a microRNA that has been studied for its diagnostic value in various diseases. In a study, it was found to have a diagnostic value of 69.5% [PMC9375662]. However, its diagnostic power was found to be low in the analysis [PMC9375662]. In another study, hsa-mir-4253 was identified as a target of the SLC6A4 gene and was upregulated in manic bipolar disorder type I [PMC9375662]. Additionally, hsa-mir-4253 was found to be downregulated in both aneurysm formation and development [PMC4222264]. Furthermore, the miRDB database identified hsa-mir-4253 as one of the miRNAs targeting RAB25 mRNA [PMC5048719]. In another study, hsa-mir-4253 was downregulated along with other miRNAs [PMC4792579]. References: - [PMC9375662]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9375662/ - [PMC4222264]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4222264/ - [PMC5048719]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5048719/ - [PMC4792579]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4792579/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGCCAUCGCCCUUGAGGGGCCCUAGGACUUACUUGUGCAGGGCAUGUCCAGGGGGUCCAGGUCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications