v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TONSL antisense RNA 1 (TONSL-AS1) URS000075A6FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TONSL-AS1: TONSL-AS1 is a gene that has been found to play different roles in different cancers [PMC7229583]. Overexpression of miR-490-3p has been shown to have an opposite effect on the overexpression of TONSL-AS1 and CDK1 [PMC7229583]. This suggests that miR-490-3p may reduce the effects of TONSL-AS1 and CDK1 overexpression [PMC7229583]. The opposite roles played by TONSL-AS1 in different cancers indicate its potential involvement in diverse biological processes [PMC7229583]. Further research is needed to fully understand the mechanisms by which TONSL-AS1 functions and its specific roles in different cancer types [PMC7229583].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGCUGCAGGGACAGAGGCGCUGCUGCUGCUGCCUGCACACAGCCGGGGUAAUGCCCCAGGGACCCGCCAUCCCUGCCCAGGGCCAGAAGCCCCCUCAGCUGCUUCUCCCAUUCCCAGGUAGCCGGCCCCUCCUCUCCCUGCAGCCCAGCACACCACCAGCCCCUCUGCUAUUCCUGGGGGCCACAGGAUCCUCCUGGAACACACCAGGGAGCCCUCGUCACACGCCCCACCCUGACAUGCAAACACGAGCACCCUGGCAUGGAGCUGCACAGGCUCACCUUUCGAGUGCGGAGGGUGACGGACGCCCCCCGUUCAAGCAGCAGCUCAGCCACCUCGAAGUGGCCACAGUUGAGGGCAUCGUGGAGGGGGGUGAUGCCUUCGCAGCCCUGGCCACCUGGGUCGUCCACUGCGGCCCCGUGGUCCAGCAGGAAGCGGACAAUUUCUGCAGACCAGGAGACGUAAGCCCAGCUCCCGAUGCCCCGCCAGGACUGACUCUUCGCCCCACGUGUCCACCAAGGUUCAAGCGAUUCUCCUGCCUCAGCCUCCCGAGUAGCUGGGACUACAGGGUCUCACUGUGUUGCCCAGGCUGGAGUGCAGUGGCAUGAUCGCGACUCCUGCAGCCUCAAUCUCCCUCCCAGGAUGAAGUGAUCCUCCUGCCUCUAGGACCACAGGUGGCCCUGAAGCUCCUCGUCCUCCUCCAGCUGCGGGGUCAGGCCAUCGGUGUCGUCCUCUGGAACAGAGCCAAGCCCACCCCAGGGGAGUCCGUGGGAGGUGAAGGCCUCAUGGACAGGCUCCUGCCACCCACCACUCAGUCAGAAACCAGCCUCCCAGCUACCCGCUAACCCCGCUCUCAGCCCUCUCUCCCUGCACCACGGCCAAGAUGGCUUCAGUCCAAGCCCCGCUCCAGCCAGUCCCUCAUGCCUGCCCUCCGUGCAGCUGAUGUCGCCAGCCUCUGGAGGAAACCCAAGCCUGCUCUGAAGGGUUUCAGGAAGGUGCUCAGCUCUUGCAGAGGCAGCCGGGGCUCUUCAAAGUGCACCGUCUCACCCCUGGCCCCAGAUGGCACGUGCCUCUCUAACGGGACCAUGCCCCAGCUGACACUCACUCGACUCCCAACCACUGUCUCCUCCAGGAGGCCAAGGCCGCCCCAGGCUCCCUGCGGGUCACCACCUUCUCUGUCCAGUUCCGGGAAAGCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications