Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-122 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-122 precursor URS000075A6F6_10090

Automated summary: This pre miRNA sequence is 66 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, MGI, Ensembl, miRBase, Ensembl/GENCODE, ENA). Described in 45 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-122, RF00684). Mus musculus (house mouse) microRNA mmu-mir-122 precursor sequence is a product of mir-122, mmu-mir-122 precursor, mir-122 precursor, Mir122, mir-122 precurso genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAACCAUCAAACGCCAUUAUCACACUAAAUAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 6 other species

    1. Balaenoptera musculus miRNA
    2. Mus caroli microRNA 122
    3. Mus pahari microRNA 122
    4. Mus spicilegus microRNA 122 (Mir122)
    5. Mus spretus microRNA 122
    6. Physeter catodon (sperm whale) microRNA 122
    7. Tursiops truncatus (bottlenosed dolphin) microRNA 122 (MIR122)
    2D structure New