Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3658 URS000075A6CE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3658: Hsa-mir-3658 is a microRNA that has been implicated in interacting with several other microRNAs, including hsa-miR-16-1-3p, hsa-miR-4698, hsa-miR-27a-3p, hsa-miR-27b-3p, hsa-miR-3662, hsa-miR-5571-5p, hsa-miR-570-3p, hsa-mir3658 itself, and others [PMC5828204]. The relative expression levels of several microRNAs, including hsa-mir3658, were calculated using the 2-delta-delta Ct method [PMC7515963]. In a study comparing patients with mild cognitive impairment due to Alzheimer's disease (MCIAD) and patients with Alzheimer's disease (AD), it was found that the expression of hsa-mir3658 was upregulated in blood leukocytes as well as in cerebrospinal fluid (CSF) and serum from MCIAD patients compared to AD patients [PMC7515963]. Hsa-mir3658 was not found to be largely expressed in all examined tissues [PMC7515963]. The expression of these four microRNAs (including hsa-mir3658) was further analyzed in blood leukocytes as well as in CSF and serum from MCIAD patients [PMC7515963]. These findings were part of a study that analyzed the expression of selected microRNAs in various biological samples from MCIAD and AD-dementia patients according to IWG2 criteria [PMC7515963].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUAAGAAAACACCAUGGAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications