Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-557 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-557 precursor URS000075A6B8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-557: Hsa-mir-557 is a microRNA that has been studied in relation to osteosarcoma [PMC8787190]. The gene sequence of KRAS was obtained from the NCBI [https://www.ncbi.nlm.nih.gov/gene] [PMC8787190]. Inctar was then used to predict the potential target site of hsa-mir-557 seed sequence [http://www.cuilab.cn/lnctar] [PMC8787190]. The study found that hsa-mir-557 inhibits the proliferation of osteosarcoma cells in vitro [PMC8787190]. This suggests that hsa-mir-557 may have potential as a therapeutic target for osteosarcoma [PMC8787190]. However, further research is needed to fully understand the mechanisms and potential clinical applications of hsa-mir-557 in osteosarcoma treatment [PMC8787190].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAUGGGCAAAUGAACAGUAAAUUUGGAGGCCUGGGGCCCUCCCUGCUGCUGGAGAAGUGUUUGCACGGGUGGGCCUUGUCUUUGAAAGGAGGUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications