Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-3473 URS000075A694_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-3473: Rno-mir-3473 is a microRNA that was found to be differentially expressed at two time points in a study using a heatmap analysis [PMC9242654]. In the same study, a total of 13 unique microRNAs, including rno-mir-3473, were identified as differentially expressed at different time points [PMC8575992]. qRT-PCR was performed to confirm the differential expression of rno-mir-3473 in an experimental group compared to control groups [PMC5270432]. The predicted target of rno-mir-3473 is Psen1 [PMC5270432]. Rno-mir-3473, along with other microRNAs, was found to have direct targets in the VEGF signaling pathway [PMC5270432]. Rno-mir-3473 was also identified as one of the microRNAs that may be affected by electroacupuncture (EA) treatment and could be related to improved functional recovery and cerebral blood supply after stroke [PMC6297779][PMC8846361]. In another study using NGS analysis, rno-mir-3473 was one of the miRNAs found to be differentially expressed [PMC4079956]. TaqMan microRNA assays were used to quantify the expression level of rno-mir-3473 in an experimental setting [PMC5578003]. References: [PMC9242654] [PMC8575992] [PMC5270432] [PMC6297779] [PMC8846361] [PMC4079956] [PM5578003]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUAGGGCUGGAGAGAUGGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications