Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 365a (ENSGGOG00000040390.1) secondary structure diagram

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 365a (ENSGGOG00000040390.1) URS000075A669_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 365a (ENSANAG00000002713.1)
  2. Canis lupus familiaris microRNA cfa-mir-365 precursor (cfa-mir-365-1)
  3. Carlito syrichta (Philippine tarsier) microRNA 365a (ENSTSYG00000019963.2)
  4. Cavia aperea (Brazilian guinea pig) microRNA 365a (ENSCAPG00000004317.1)
  5. Cavia porcellus microRNA 365a (ENSCPOG00000019343.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 365a (ENSCCAG00000009379.1)
  7. Cercocebus atys microRNA 365a (ENSCATG00000017893.1)
  8. Colobus angolensis palliatus miRNA (ENSCANG00000016833.1)
  9. Equus caballus (horse) microRNA eca-mir-365 precursor (eca-mir-365-2)
  10. Homo sapiens microRNA hsa-mir-365a precursor
  11. Ictidomys tridecemlineatus microRNA 365a (ENSSTOG00000016582.1)
  12. Loxodonta africana (African savanna elephant) microRNA 365a (ENSLAFG00000024281.1)
  13. Macaca mulatta microRNA mml-mir-365 precursor (mml-mir-365-1)
  14. Macaca nemestrina (Pig-tailed macaque) microRNA 365a (ENSMNEG00000020760.1)
  15. Mandrillus leucophaeus (Drill) microRNA 365a (ENSMLEG00000013922.1)
  16. Mesocricetus auratus (Golden Hamster) microRNA 365-1 (ENSMAUG00000002220.1)
  17. Microcebus murinus (gray mouse lemur) microRNA 365a (ENSMICG00000018996.3)
  18. Microtus ochrogaster (vole) microRNA 365-1 (ENSMOCG00000006915.1)
  19. Mus pahari microRNA 365-1 (MGP_PahariEiJ_G0006733.1)
  20. Myotis lucifugus microRNA 365a (ENSMLUG00000017859.1)
  21. Nannospalax galili microRNA 365-1 (ENSNGAG00000001597.1)
  22. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 365a (ENSNLEG00000021265.2)
  23. Otolemur garnettii (small-eared galago) microRNA 365a (ENSOGAG00000017550.1)
  24. Pan paniscus (bonobo) microRNA 365a (ENSPPAG00000004945.1)
  25. Pan troglodytes ptr-mir-365-1 (ENSPTRG00000027657.2)
  26. Pongo abelii miRNA
  27. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-365 precursor (ppy-mir-365-1)
  28. Procavia capensis (cape rock hyrax) microRNA 365a (ENSPCAG00000019618.1)
  29. Propithecus coquereli (Coquerel's sifaka) microRNA 365a (ENSPCOG00000000566.1)
  30. Pteropus vampyrus (large flying fox) microRNA 365a (ENSPVAG00000026726.1)
  31. Rhinopithecus bieti microRNA 365a (ENSRBIG00000023018.1)
  32. Rhinopithecus roxellana microRNA 365a (ENSRROG00000001460.1)
  33. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 365a (ENSSBOG00000009580.1)
  34. Sorex araneus microRNA 365a (ENSSARG00000016647.1)
  35. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016000.1)
2D structure Publications