Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-365a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-365a precursor URS000075A669_9606

  • 87 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 35 species

Automated summary: This pre miRNA sequence is 87 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, Ensembl, GeneCards, miRBase, Ensembl/GENCODE, ENA, MalaCards, HGNC). Described in 41 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-365, RF00659). Homo sapiens (human) microRNA hsa-mir-365a precursor sequence is a product of MIR365A, hsa-mir-365a precursor, mir-365a, mir-365a precursor, mir-365a precurso genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Aotus nancymaae microRNA 365a (MIR365A)
    3. Canis lupus familiaris microRNA cfa-mir-365 precursor (cfa-mir-365-1)
    4. Carlito syrichta (Philippine tarsier) microRNA 365a (MIR365A)
    5. Cavia aperea (Brazilian guinea pig) microRNA 365a
    6. Cavia porcellus microRNA 365a
    7. Cercocebus atys (Sooty mangabey) microRNA 365a (MIR365A)
    8. Colobus angolensis palliatus miRNA
    9. Equus caballus (horse) microRNA eca-mir-365 precursor (eca-mir-365-2)
    10. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 365a
    11. Ictidomys tridecemlineatus microRNA 365a (MIR365A)
    12. Loxodonta africana microRNA 365a
    13. Macaca fascicularis (Crab-eating macaque) miRNA
    14. Macaca mulatta microRNA mml-mir-365 precursor (mml-mir-365-1)
    15. Macaca nemestrina microRNA 365a (MIR365A)
    16. Mandrillus leucophaeus (Drill) microRNA 365a (MIR365A)
    17. Mesocricetus auratus (Golden Hamster) microRNA 365-1 (Mir365-1)
    18. Microcebus murinus miRNA
    19. Microtus ochrogaster microRNA 365-1
    20. Mus pahari microRNA 365-1
    21. Myotis lucifugus microRNA 365a (MIR365A)
    22. Nannospalax galili microRNA 365-1 (Mir365-1)
    23. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    24. Otolemur garnettii (small-eared galago) microRNA 365a (MIR365A)
    25. Pan paniscus (bonobo) miRNA
    26. Pan troglodytes (chimpanzee) ptr-mir-365-1
    27. Papio anubis (Olive baboon) miRNA
    28. Pongo abelii microRNA 365a
    29. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-365 precursor (ppy-mir-365-1)
    30. Procavia capensis (cape rock hyrax) microRNA 365a (MIR365A)
    31. Propithecus coquereli (Coquerel's sifaka) microRNA 365a (MIR365A)
    32. Pteropus vampyrus microRNA 365a (MIR365A)
    33. Rhinopithecus bieti microRNA 365a (MIR365A)
    34. Rhinopithecus roxellana microRNA 365a (MIR365A)
    35. Saimiri boliviensis boliviensis microRNA 365a (MIR365A)
    36. Sorex araneus microRNA 365a (MIR365A)
    37. Vicugna pacos (alpaca) miRNA
    2D structure New