Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-155 URS000075A65A_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-155: In summary, our results reveal that IBDV infection induces gga-mir-155 expression [PMC5845882]. The 3′ UTR of IRF4 and LRRC59 containing gga-miR-101-3p and gga-mir-155 binding sites were amplified from chicken genomic DNA [PMC5573731]. This suggests that gga-mir-155 may play a role in the regulation of IRF4 and LRRC59 genes [PMC5573731]. The upregulation of gga-mir-155 in response to IBDV infection may have implications for the immune response in chickens [PMC5845882]. MicroRNAs are small non-coding RNA molecules that regulate gene expression by binding to the 3′ UTR of target genes [PMC5845882]. The binding of gga-mir-155 to target genes can lead to post-transcriptional gene silencing or translational repression [PMC5573731]. In the context of IBDV infection, the upregulation of gga-mir-155 suggests its involvement in modulating immune responses or other cellular processes [PMC5845882]. Further research is needed to fully understand the role of gga-mir-155 in IBDV infection and its potential implications for chicken health [PMC5845882].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAUGCUAAUCGUGAUAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Anolis carolinensis aca-miR-155-5p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-155
  3. Chrysemys picta cpi-miR-155a-5p
  4. Cricetulus griseus (Chinese hamster) cgr-miR-155
  5. Cyprinus carpio (common carp) ccr-miR-155
  6. Danio rerio dre-miR-155
  7. Gorilla gorilla gorilla ggo-miR-155 (MIR155)
  8. Gorilla gorilla (western gorilla) ggo-miR-155
  9. Tor tambroides miR-155
  10. Xenopus tropicalis xtr-miR-155
Publications