Cyprinus carpio (common carp) ccr-miR-155

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cyprinus carpio (common carp) ccr-miR-155 URS000075A65A_7962

22 nucleotides
1 database (miRBase)
Found in 10 other species
2 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUAAUGCUAAUCGUGAUAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Anolis carolinensis aca-miR-155-5p
Callithrix jacchus (white-tufted-ear marmoset) cja-miR-155
Chrysemys picta cpi-miR-155a-5p
Cricetulus griseus (Chinese hamster) cgr-miR-155
Danio rerio dre-miR-155
Gallus gallus gga-miR-155
Gorilla gorilla gorilla ggo-miR-155 (MIR155)
Gorilla gorilla (western gorilla) ggo-miR-155
Tor tambroides miR-155
Xenopus tropicalis xtr-miR-155

Publications