Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6891-3p URS000075A640_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6891: Hsa-mir-6891 is an annotated microRNA (miRNA) encoded by intron 4 of the HLA-B gene [PMC5437213]. The pre-miRNA hairpin sequence of hsa-mir-6891 is evolutionarily conserved, with 90% sequence identity among six primate species [PMC5437213]. In contrast, the closest homolog of hsa-mir-6891 in the mouse genome has only 48% sequence conservation and does not encode an annotated miRNA [PMC5437213]. Hsa-mir-6891 is classified as one of the overmutated miRNA genes in various cancer types [PMC7648123]. The analysis identified hsa-mir-6891 as one of the candidate driver genes in Pan-Cancer, along with seven other miRNA genes [PMC7648123]. In addition to Pan-Cancer, hsa-mir-6891 was also identified as a candidate driver gene in CESC (Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma) [PMC7648123]. The weighted analysis and OncodriveFML analysis both identified hsa-mir-6891 as an overlapping miRNA gene in CESC and Pan-Cancer [PMC7648123].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUCAUCUUCCCCUCCUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications