Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MED4 antisense RNA 1 (MED4-AS1) URS000075A5E9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MED4-AS1: MED4-AS1 is a long non-coding RNA (lncRNA) that has been identified as a potential biomarker for the prognosis of patients with non-small cell lung cancer (NSCLC) [PMC9997791]. In a study that constructed a competing endogenous RNA (ceRNA) network using data from The Cancer Genome Atlas (TCGA), MED4-AS1 was found to be one of the 113 differentially expressed lncRNAs, along with 12 differentially expressed miRNAs and 36 differentially expressed mRNAs [PMC9997791]. This suggests that MED4-AS1 may play a role in the development and progression of NSCLC. Additionally, another study specifically focused on lung adenocarcinoma found that MED4-AS1 was associated with prognosis in this subtype of NSCLC [PMC9519990]. The study identified MED4-AS1 as one of the lncRNAs that may serve as valuable biomarkers for predicting patient outcomes [PMC9519990]. These findings highlight the potential significance of MED4-AS1 in NSCLC and suggest its potential as a prognostic marker. Further research is needed to fully understand the functional role and clinical implications of MED4-AS1 in NSCLC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCAAUCAGACUCACUACUACUGCUUGAGGAGUCCGUUGACAUAAUCUCUACAUCAUCUUCAUUUUCUUUAUUAUGCCCAGGAGGUUCCAACAAAAAGUCACUACUAUGAUUUGGUGGUAACAUAUUCAUCGACAUGUCAUUUGACUGCCAUGGAUACUGUGGAGCAAGGACAUCUGGAGAAAAAAAGAAGCAUAGAUAAGAACAGCUCUAUCUGGUCUCAUUCUGUCACCCAGGCUUGAGUGCAGUGGCACGAAUACAUCACUGAAGCCCUGACCUAGGCUCAAGCAAUCCUCCUGCCUCAGCCUCCUGAGUAACUGGGUUACAGAUAUUCCAACCUUGUCAUCUCUGGAAAACCCUGAUCUGUUUGAAAACACUCUUCGGCUUAACAUUACCUGGCAAUCUUCCUGCUGCAAGUGCAUCUCCUGGUAAAUGGCCAUUCACGCCAUUAGUGGAAGGAUUGUUCAUCUGACCCAGUAACCCACUUCUCAUCUCUAAAUCAGUUGGGUAGGGUCUCCGGGGGUCCCCUAAAACAAUAAAGACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications