Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-564 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-564 precursor URS000075A5C3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-564: Hsa-mir-564 is a microRNA that has been identified in various studies across different contexts. In one study, hsa-mir-564 was found to be upregulated in exosomes in the culture medium of the UVA group, indicating its potential role in response to UVA radiation [PMC7719707]. Another study identified hsa-mir-564 as part of a seven-miRNA signature associated with schizophrenia, where its expression was correlated with negative symptoms and neurocognitive performance [PMC3726785]. In a comparison between milk cells and fat cells, hsa-mir-564 was found to be higher in fat cells [PMC4745068]. However, it should be noted that hsa-mir-564 was not detected in certain samples and was excluded from subsequent analysis [PMC4478345]. Additionally, hsa-mir-564 has been implicated in breast cancer progression and tamoxifen resistance [PMC5013276][PMC2970572]. In the context of type 1 diabetes (T1D), hsa-mir-564 was identified as part of a regulatory network involving target genes and transcription factors associated with T1D development [PMC8028841]. Furthermore, studies have shown that hsa-mir-564 is upregulated in certain conditions such as liver cancer cells (L02/HBx) and preterm infants with schizophrenia [PMC5352919][PMC5068884][PMC8049460]. Overall, these studies highlight the potential role of hsa-mir-564 across different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGCAGCGGGUGCCAGGCACGGUGUCAGCAGGCAACAUGGCCGAGAGGCCGGGGCCUCCGGGCGGCGCCGUGUCCGCGACCGCGUACCCUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications