Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1184 precursor (hsa-mir-1184 1 to 3) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1184 precursor (hsa-mir-1184 1 to 3) URS000075A55D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1184: Hsa-mir-1184 is a microRNA that has been identified in various studies as potentially playing a role in different diseases and biological processes [PMC5902673]. It has been found to be one of the microRNAs that may interact with GAPLINC, a long non-coding RNA [PMC5902673]. In one study, hsa-mir-1184 was selected as one of the superior candidates based on comprehensive assessments and was found to be highly related to GAPLINC [PMC5902673]. Hsa-mir-1184 has also been found to have deregulated expression in prostatic cancer [PMC5452331]. In addition, it has been identified as one of the miRNAs that may be involved in different diseases such as sepsis, inflammatory bowel disease, rheumatoid arthritis, systemic lupus erythematosus, and type 1 diabetes [PMC9259025]. Furthermore, hsa-mir-1184 has been shown to have functional synergistic relationships with other miRNAs such as hsa-miR-1207-5p and hsa-miR-24 [PMC5228663]. It is also worth noting that hsa-mir-1184 shares target genes with other miRNAs such as hsa-miR-24 and may play a role in the development of certain diseases like pancreatic cancer and breast tumor metastasis [PMC5228663].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGCAGAACGAGGUGAAGGAGGUGGUUCUGCUCAGCAGUCAACAGUGGCCACAUCUCCACCUGCAGCGACUUGAUGGCUUCCGUGUCCUUUUCGUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

2D structure Publications