Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-2052 precursor URS000075A536_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2052: Hsa-mir-2052 is a microRNA that has been identified as having a strong link with various entities. According to a study, the target score values indicate the strongest associations between UBA2 and hsa-miR-133a-3p, hsa-miR-133b, GLO1 and hsa-miR-561-5p, STATH and hsa-miR-137-3p, hsa-miR-580-3p, and TUFT1 and hsa-miR-1233-3p [PMC9389532]. The expression of hsa-mir-2052 has been found to be significantly higher in ovarian cancer samples compared to control samples [PMC9389532]. Hsa-mir-2052 has been shown to bind to the S segment of various viruses belonging to Clade A NW [PMC7709035]. Additionally, it has been found that both hsa-mir-2052 and hsa-mir410–5p interact with RA, while hsa-mir676–3p and hsa-mir4693–3p interact with SLE and T1D. These miRNAs have been identified as common miRNAs that target multiple viral proteins in SARS-CoV-2 [PMC9259025]. Hsa-mir2052 has also been implicated in non-small cell lung cancer as a downregulated response to SOX2 and a potential candidate for chemoresistant therapy [PMC9259025]. Furthermore, miRNAs including hsa-miR365a–3p, hsamir2052, hsamiR3065–3p have been predicted for gene ADM [PMC9260904]. The regulatory network analysis revealed that several miRNAs including hsamir2052 interact with both ORF1ab and spike proteins of the virus [PMC8197616]. Lastly, miRNAs such as hsa-mir2052 have been predicted to target genes such as CYP1A1, CYP1B1, C7, ADCY2, SERPINB5, and ANAPC13 [PMC7473858].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUUUUGAUAACAGUAAUGUCCCUUUAGUUCAAAGUUACCAGCUAUCAAAACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Bison bison bison miRNA (ENSBBBG00000023846.1)
  2. Bos grunniens microRNA 2052 (ENSBGRG00000015887.1)
  3. Bos mutus (wild yak) miRNA (ENSBMUG00000019355.1)
  4. Camelus dromedarius (Arabian camel) microRNA 2052 (ENSCDRG00005013020.1)
  5. Canis lupus dingo microRNA 2052 (ENSCAFG00020017837.1)
  6. Canis lupus familiaris miRNA (ENSCAFG00000041660.2, ENSCAFG00030013298.1, ENSCAFG00040018016.1, ENSCAFG00845029187.1)
  7. Capra hircus miRNA (ENSCHIG00010005781.1)
  8. Cervus hanglu yarkandensis microRNA 2052 (ENSCHYG00000010180.1)
  9. Equus asinus asinus microRNA 2052 (ENSEASG00005020224.1)
  10. Equus asinus (ass) microRNA 2052 (ENSEASG00005020224.2)
  11. Equus caballus (horse) microRNA 2052 (ENSECAG00000028449.1)
  12. Felis catus (domestic cat) microRNA 2052 (ENSFCAG00000046875.1)
  13. Macaca fascicularis microRNA 2052 (ENSMFAG00000060051.1)
  14. Macaca mulatta microRNA 2052 (ENSMMUG00000054374.1)
  15. Marmota marmota marmota microRNA 2052 (ENSMMMG00000005368.1)
  16. Neogale vison microRNA 2052 (ENSNVIG00000015202.1)
  17. Oryctolagus cuniculus (rabbit) microRNA 2052 (ENSOCUG00000032559.1)
  18. Ovis aries (sheep) microRNA 2052 (ENSOARG00020014723.2)
  19. Panthera leo (lion) microRNA 2052 (ENSPLOG00000004791.1)
  20. Pan troglodytes miRNA
  21. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000014185.1)
  22. Pongo abelii microRNA 2052 (ENSPPYG00000034906.1)
  23. Sciurus vulgaris (Eurasian red squirrel) microRNA 2052 (ENSSVLG00005002339.1)
  24. Spermophilus dauricus miRNA (ENSSDAG00000014144.1)
  25. Theropithecus gelada (gelada) microRNA 2052 (ENSTGEG00000023519.1)
  26. Urocitellus parryii microRNA 2052 (ENSUPAG00010011518.1)
  27. Vulpes vulpes microRNA 2052 (ENSVVUG00000019512.1)
Publications