Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pteropus vampyrus (large flying fox) microRNA 137 (ENSPVAG00000024671.1) secondary structure diagram

Pteropus vampyrus (large flying fox) microRNA 137 (ENSPVAG00000024671.1) URS000075A4FB_132908

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000006410.1)
  2. Bos taurus microRNA bta-mir-137 precursor
  3. Capra hircus chi-mir-137 (ENSCHIG00000001488.1)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 137 (ENSCCAG00000008925.1)
  5. Cercocebus atys miRNA (ENSCATG00000000822.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 137 (ENSCSAG00000021688.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000017015.1)
  8. Gorilla gorilla gorilla microRNA 137 (ENSGGOG00000039706.1)
  9. Homo sapiens microRNA hsa-mir-137 precursor
  10. Loxodonta africana (African savanna elephant) microRNA 137 (ENSLAFG00000024092.1)
  11. Macaca mulatta microRNA mml-mir-137 precursor
  12. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000007060.1)
  13. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000020143.1)
  14. Microcebus murinus (gray mouse lemur) microRNA 137 (ENSMICG00000031189.2)
  15. Mustela putorius furo (Domestic ferret) microRNA 137 (ENSMPUG00000020390.1)
  16. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 137 (ENSNLEG00000022049.2)
  17. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017506.2)
  18. Ovis aries miRNA (ENSOARG00000023853.1)
  19. Pan paniscus (bonobo) microRNA 137 (ENSPPAG00000020126.1)
  20. Panthera pardus microRNA 137 (ENSPPRG00000013615.1)
  21. Panthera tigris altaica microRNA 137 (ENSPTIG00000003233.1)
  22. Pan troglodytes ptr-mir-137 (ENSPTRG00000027612.2)
  23. Pongo abelii miRNA
  24. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-137 precursor
  25. Rhinopithecus bieti miRNA (ENSRBIG00000014820.1)
  26. Rhinopithecus roxellana microRNA 137 (ENSRROG00000009555.1)
  27. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000001244.1)
  28. Sorex araneus microRNA 137 (ENSSARG00000015094.1)
  29. Tursiops truncatus (bottlenosed dolphin) microRNA 137 (ENSTTRG00000024022.1)
2D structure