Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-137 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-137 precursor URS000075A4FB_9606

  • 102 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 56 species

Automated summary: This pre miRNA sequence is 102 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, HGNC, Ensembl/GENCODE, miRBase, Ensembl, GeneCards, MalaCards, RefSeq). Described in 54 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-137, RF00694). Homo sapiens (human) microRNA hsa-mir-137 precursor sequence is a product of ENSG00000284202.1, hsa-mir-137 precursor, mir-137 precursor, MIR137, mir-137 precurso, mir-137 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 137
    2. Aotus nancymaae miRNA (ENSANAG00000006410.1)
    3. Bos taurus (cattle) microRNA bta-mir-137 precursor
    4. Capra hircus chi-mir-137 (ENSCHIG00000001488.1)
    5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000000822.1)
    6. Chlorocebus sabaeus miRNA (ENSCSAG00000021688.1)
    7. Colobus angolensis palliatus microRNA 137 (ENSCANG00000017015.1)
    8. Gorilla gorilla gorilla microRNA 137 (ENSGGOG00000039706.1)
    9. Loxodonta africana (African savanna elephant) microRNA 137 (ENSLAFG00000024092.1)
    10. Macaca fascicularis (Crab-eating macaque) miRNA
    11. Macaca mulatta microRNA mml-mir-137 precursor
    12. Macaca nemestrina miRNA (ENSMNEG00000007060.1)
    13. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000020143.1)
    14. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000031189.2)
    15. Mustela putorius furo (Domestic ferret) microRNA 137 (ENSMPUG00000020390.1)
    16. Nomascus leucogenys miRNA (ENSNLEG00000022049.2)
    17. Otolemur garnettii miRNA (ENSOGAG00000017506.2)
    18. Ovis aries (sheep) miRNA (ENSOARG00000023853.1)
    19. Pan paniscus miRNA (ENSPPAG00000020126.1)
    20. Panthera pardus microRNA 137 (ENSPPRG00000013615.1)
    21. Panthera tigris altaica (Tiger) microRNA 137 (ENSPTIG00000003233.1)
    22. Pan troglodytes (chimpanzee) ptr-mir-137 (ENSPTRG00000027612.2)
    23. Papio anubis miRNA (ENSPANG00000013343.2)
    24. Pongo abelii microRNA 137 (ENSPPYG00000021890.1)
    25. Pongo pygmaeus microRNA ppy-mir-137 precursor
    26. Pteropus vampyrus microRNA 137 (ENSPVAG00000024671.1)
    27. Rhinopithecus bieti miRNA (ENSRBIG00000014820.1)
    28. Rhinopithecus roxellana microRNA 137 (ENSRROG00000009555.1)
    29. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000001244.1)
    30. Sorex araneus microRNA 137 (ENSSARG00000015094.1)
    31. Tursiops truncatus microRNA 137 (ENSTTRG00000024022.1)
    2D structure New