Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-630 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-630 precursor URS000075A45A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-630: Hsa-mir-630 is the most abundant extracellular miR, and it has been found to regulate airway epithelial cell death and survival, as well as maintain a complex regulation of its cell cycle and apoptotic balance [PMC5028059]. In a study, quantitative RT-PCR analyses were conducted using an ABI PRISM 7900 instrument and Assay-on-Demand TaqMan probes for Lefty1, miR-630 (hsa-mir-630), and miR-5703 [PMC4074034]. The study followed the manufacturer's protocols from Agilent Technologies for these analyses [PMC4074034].

MIR630: MIR630 is a type of microRNA that has been studied in relation to tumorigenesis. According to a study [PMC9753082], the level of MIR630 was significantly lower in both types of HO. This suggests that MIR630 may play a role in controlling tumorigenesis [PMC8744645]. In NT2/D1 cells, the expression of NANOG, OCT4, and SOX2 proteins was inhibited after transfection with MIR630 mimic compared to control cells [PMC8744645]. Specifically, the expression of NANOG was inhibited by 69%, OCT4 by 70%, and SOX2 by 32% [PMC8744645]. These findings indicate that MIR630 may have an inhibitory effect on the expression of these proteins in NT2/D1 cells [PMC8744645]. Overall, these studies suggest that MIR630 may have an important role in controlling tumorigenesis and regulating the expression of key proteins involved in pluripotency and stem cell maintenance [PMC9753082] [PMC8744645].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUUAACAUCAUGCUACCUCUUUGUAUCAUAUUUUGUUAUUCUGGUCACAGAAUGACCUAGUAUUCUGUACCAGGGAAGGUAGUUCUUAACUAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications