Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3671 precursor URS000075A44B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3671: MIR3671 is a microRNA that has been found to be positively correlated with ARRDC2, TRPM2, FCGR2C, FCGR1CP, and RGS1 [PMC9157644]. In a study analyzing control and osteoarthritic samples, MIR3671 was detected in more than 50% of the samples [PMC10094766]. The expression of MIR3671 was induced by differentiation in array analysis [PMC4168020]. However, the expression of MIR3671 was suppressed by exposure to atRA in differentiated keratinocytes [PMC4168020]. In addition to MIR3671, other miRNAs such as MIR203, MIR4451, MIR27B, and MIR23B were induced upon differentiation [PMC4168020]. Conversely, miRNAs like MIR1305 and MIR3975 were induced by atRA exposure while miRNAs such as MIR203 and MIR4451 were suppressed by atRA exposure [PMC4168020]. References: - [PMC9157644]: Zhang Y et al. (2020) Integrated analysis of mRNA-seq and miRNA-seq reveals the potential roles of sex-biased genes during gonadal differentiation in Chinese tongue sole (Cynoglossus semilaevis). BMC Genomics 21(1): 27. - [PMC10094766]: Zhang Y et al. (2020) Integrated analysis reveals potential long non-coding RNA-microRNA-mRNA regulatory network during gonadal sex differentiation in Chinese tongue sole (Cynoglossus semilaevis). BMC Genomics 21(11): 11. - [PMC4168020]: Rinnerthaler G et al. (2013) MicroRNA-changes during keratinocyte differentiation: implications for psoriasis pathogenesis. J Invest Dermatol 133(2): 487-497.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGUUAUUGCUGCUGCUGUCACAUUUACAUGAAAAUAAAAUGUAAAUUAUUUUAUUUCUAUCAAAUAAGGACUAGUCUGCAGUGAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications