Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4268 precursor URS000075A41B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4268: Hsa-mir-4268 is a microRNA that has been implicated in various biological processes and diseases. It has been shown to regulate EPHB2 expression and mediate extracellular matrix degradation through circRBM33 [PMC8603816]. Hsa-mir-4268 is found in different forms, with the 3' addition isomiR being the most frequent [PMC9226005]. Luciferase activity assays demonstrated that hsa-mir-4268 mimics decreased luciferase activity in certain groups, indicating its regulatory role [PMC8201884]. Hsa-mir-4268 has been found to target circ-G042080 and TLR4 expression, suggesting its involvement in the Toll-like receptor signaling pathway and myocardial damage associated with multiple myeloma [PMC8201884]. In MM patients, exosomes derived from MM patients led to increased levels of circ-G042080 and TLR4, while hsa-mir-4268 levels decreased [PMC8201884]. Hsa-mir-4268 has also been implicated in other diseases. It was found to have differential expression in patients with metastatic melanoma before and after surgical resection [PMC8258953]. Additionally, hsa-mir-4268 overexpression inhibited cell proliferation and induced apoptosis of gastric cancer cells, suggesting its potential role as a tumor suppressor in gastric cancer development [PMC8258953]. In a non-coding RNA network analysis, hsa_circ_0062682 was shown to closely interact with hsa-mir-4268 [PMC8258953]. Overall, hsa-mir-4268 appears to play a significant role in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCACAUCAGGUUCUAGAGGUUUUGCCCUAGCGGCUCCUCCUCUCAGGAUGUGAUGUCACCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications