Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4467 URS000075A41A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4467: Hsa-mir-4467 is a differentially expressed miRNA that has been predicted to have interaction relationships with several other molecules. The DIANA-LncBase database predicted interaction relationship pairs between hsa-mir-4467 and four differentially expressed lncRNAs (LINC00910, MAPKAPK5-AS1, SMCR5, and WWC2-AS2) [PMC7666708]. The starBase database also predicted paired interactions between hsa-mir-4467 and nine differentially expressed genes (DEGs) [PMC7666708]. Hsa-mir-4467 has been implicated in breast cancer [PMC4247319]. In a study on grade III and IV glioma patients, hsa-mir-4467 was found to be overexpressed [PMC4247319]. Hsa-mir-4467 was also identified as one of the nine most informative miRNAs in a study using the MoR plot method [PMC4439119]. However, it was excluded from further analysis in a study on ACBP-3 due to differential expression not being observed across two chips [PMC8107736]. Overall, hsa-mir-4467 is a differentially expressed miRNA that has been implicated in breast cancer and glioma. It has predicted interaction relationships with lncRNAs and DEGs. However, its differential expression may vary depending on the context of the study.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCGGCGGUAGUUAUGGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications