Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-297 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-297 precursor URS000075A3FD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-297: Hsa-mir-297 is a microRNA that plays a role in the positive regulation of miRNA-mediated repression [PMC3794589]. To investigate this phenomenon, a study analyzed the role of Pumilio proteins in miRNA-mediated repression using microarray analysis on HEK293 cells [PMC3794589]. The cells were transfected with either a negative control, hsa-mir-297, or hsa-mir-297 along with PUM1/2 double knockdown [PMC3794589]. The results of the analysis were presented in Supplementary Table S5 [PMC3794589]. In addition, the study examined the enrichment of PVT1 and hsa-mir-297 with an anti-Ago antibody compared to an anti-normal IgG antibody [PMC9008320]. The results showed that both PVT1 and hsa-mir-297 were substantially enriched with the anti-Ago antibody [PMC9008320]. This finding suggests that hsa-mir-297 is involved in miRNA-mediated repression and is associated with Ago proteins [PMC9008320]. Overall, this study provides evidence for the positive regulation of miRNA-mediated repression by Pumilio proteins and highlights the enrichment of hsa-mir-297 with Ago proteins [PMC3794589] [PMC9008320]. These findings contribute to our understanding of the regulatory mechanisms involved in miRNA-mediated repression.

MIR297: MIR297 is a miRNA that has been studied in various contexts [PMC8709190]. In vitro studies have shown that lnc-SLC15A1-1, chemokines CXCL10 and CXCL8, and miRNAs miR-150-3p, miR-27b-5p, and MIR297 play important roles [PMC8709190]. In a comparison between BPDCN and AMLTET2m, lower expression levels of CPA3, ATP8B4, SPINK2, TRGJP1, and CDK6 were observed in BPDCN while SULF2, MIR297, and miR708 were higher [PMC6898719]. Some miRNAs were not expressed using the miRNeasy extraction method including MIR297 [PMC5025515]. Upregulation of MIR297 has been found to activate NF-kB leading to increased inflammation and apoptosis [PMC9028838]. It is possible that MIR297 is controlled by SEs located near Slc39a11 in RCS cells [PMC4787819].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAUGUAUGUGUGCAUGUGCAUGUAUGUGUAUAUACAUAUAUAUGUAUUAUGUACUCAUAUAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications