Macaca fascicularis (Crab-eating macaque) miRNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca fascicularis (Crab-eating macaque) miRNA URS000075A3C1_9541

91 nucleotides
1 database (Ensembl)
Found in 12 other species
miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGCUGGAAAGGAAGAAGCAUUCUUUCAUUGGUUGGUGUGUAUUGCCUUGUCAACCAAUAAGAGGAUGCCAUUUAUCCUUUUCUGACUAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Cercocebus atys microRNA 1179 (ENSCATG00000042716.1)
Colobus angolensis palliatus miRNA (ENSCANG00000038549.1)
Gorilla gorilla gorilla microRNA 1179 (ENSGGOG00000030426.2)
Homo sapiens microRNA hsa-mir-1179 precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 1179 (ENSMNEG00000005017.1)
Mandrillus leucophaeus (Drill) microRNA 1179 (ENSMLEG00000017679.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1179 (ENSNLEG00000023108.2)
Pan paniscus (bonobo) microRNA 1179 (ENSPPAG00000014573.1)
Pan troglodytes ptr-mir-1179 (ENSPTRG00000034862.2)
Rhinopithecus bieti microRNA 1179 (ENSRBIG00000012183.1)
Rhinopithecus roxellana microRNA 1179 (ENSRROG00000006538.1)

2D structure