Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1179 precursor URS000075A3C1_9606

  • 91 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 11 species

Automated summary: This pre miRNA sequence is 91 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl, ENA, Ensembl/GENCODE, GeneCards, RefSeq, HGNC, MalaCards, miRBase). Described in 20 papers. Matches 1 Rfam family (mir-1179, RF03469). Homo sapiens (human) microRNA hsa-mir-1179 precursor sequence is a product of mir-1179 precursor, hsa-mir-1179 precursor, mir-1179 precurso, mir-1179, MIR1179 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCUGGAAAGGAAGAAGCAUUCUUUCAUUGGUUGGUGUGUAUUGCCUUGUCAACCAAUAAGAGGAUGCCAUUUAUCCUUUUCUGACUAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Cercocebus atys (Sooty mangabey) microRNA 1179 (MIR1179)
    2. Colobus angolensis palliatus microRNA 1179
    3. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 1179
    4. Macaca fascicularis (Crab-eating macaque) miRNA
    5. Macaca nemestrina microRNA 1179 (MIR1179)
    6. Mandrillus leucophaeus (Drill) microRNA 1179 (MIR1179)
    7. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    8. Pan paniscus (bonobo) miRNA
    9. Pan troglodytes (chimpanzee) ptr-mir-1179
    10. Papio anubis (Olive baboon) miRNA
    11. Rhinopithecus bieti microRNA 1179 (MIR1179)
    12. Rhinopithecus roxellana microRNA 1179 (MIR1179)