Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ixodes scapularis (black-legged tick) isc-miR-219 URS000075A3A0_6945

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUUGUCCAAACGCAAUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-219-5p
  2. Danio rerio dre-miR-219-5p
  3. Daphnia pulex dpu-miR-219
  4. Mus musculus Mus_musculus piRNA piR-mmu-49318997
  5. Neolamprologus brichardi (lyretail cichlid) nbr-miR-219c
  6. Paralichthys olivaceus pol-miR-219-5p
  7. Pundamilia nyererei pny-miR-219b
  8. Taeniopygia guttata (zebra finch) tgu-miR-219a
  9. Takifugu rubripes fru-miR-219
  10. Tetraodon nigroviridis tni-miR-219
Publications