Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neolamprologus brichardi (lyretail cichlid) nbr-miR-219c URS000075A3A0_32507

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUUGUCCAAACGCAAUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-219-5p
  2. Danio rerio dre-miR-219-5p
  3. Daphnia pulex dpu-miR-219
  4. Ixodes scapularis isc-miR-219
  5. Mus musculus Mus_musculus piRNA piR-mmu-49318997
  6. Paralichthys olivaceus pol-miR-219-5p
  7. Pundamilia nyererei pny-miR-219b
  8. Taeniopygia guttata (zebra finch) tgu-miR-219a
  9. Takifugu rubripes fru-miR-219
  10. Tetraodon nigroviridis tni-miR-219