Takifugu rubripes (torafugu) fru-miR-219 URS000075A3A0_31033

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 10 other species
• 11 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAUUGUCCAAACGCAAUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Bos taurus bta-miR-219-5p
2. Danio rerio dre-miR-219-5p
3. Daphnia pulex dpu-miR-219
4. Ixodes scapularis isc-miR-219
5. Mus musculus Mus_musculus piRNA piR-mmu-49318997
6. Neolamprologus brichardi (lyretail cichlid) nbr-miR-219c
7. Paralichthys olivaceus pol-miR-219-5p
8. Pundamilia nyererei pny-miR-219b
9. Taeniopygia guttata (zebra finch) tgu-miR-219a
10. Tetraodon nigroviridis tni-miR-219

Publications Download

• FASTA
• JSON