Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-219-5p URS000075A3A0_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 3 databases (ENA, miRBase, RefSeq). Described in 12 papers. Danio rerio (zebrafish) dre-miR-219-5p sequence is a product of miR-219, dre-miR-219-5p, mir219-2, mir219-3, dre-miR-219, miR-219-5p, mir219-1 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAUUGUCCAAACGCAAUUCUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 88 other species

    1. Bos taurus bta-miR-219-5p
    2. Daphnia pulex (common water flea) dpu-miR-219
    3. Ixodes scapularis (black-legged tick) isc-miR-219
    4. Mus musculus Mus_musculus piRNA piR-mmu-49318997
    5. Neolamprologus brichardi nbr-miR-219c
    6. Paralichthys olivaceus (Japanese flounder) pol-miR-219-5p
    7. Pundamilia nyererei pny-miR-219b
    8. Taeniopygia guttata (zebra finch) tgu-miR-219a
    9. Takifugu rubripes (torafugu) fru-miR-219
    10. Tetraodon nigroviridis tni-miR-219
    Publications New