Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1231 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1231 precursor URS000075A358_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1231: Hsa-mir-1231 is a microRNA that has been found to play a role in various biological processes. In HBV-transfected HepG2 cells, over-expression of hsa-mir-1231 suppressed HBV replication by targeting the HBV core protein [PMC6177563]. Hsa-mir-1231 is part of a putative ceRNA network that includes three miRNAs (hsa-miR-152-3p, hsa-miR-762, and hsa-mir-1231) [PMC7202328]. This ceRNA network involves three lncRNAs (HOXD-AS2, LINC01123, and FIRRE), three miRNAs (hsa-miR-152-3p, hsa-miR-762, and hsa-mir-1231), and four genes (MED12, RHBG, NCAM1, and ARF4) [PMC7202328]. Hsa-mir-1231 has been found to be differentially expressed in various studies. For example, it was up-regulated in HBV-transfected HepG2 cells [PMC7085209] and was also differentially expressed in NHDF cell cultures treated with a biological drug [PMC5816894]. Hsa-mir-1231 has also been implicated in various diseases. In colorectal cancer (CRC), it was found to be associated with prognosis along with other miRNAs [PMC8975208]. Additionally, it was found to be located in differentially hypermethylated regions in CMML samples compared to healthy donor samples [PMC3273467]. Hsa-mir-1231 has the potential to interact with other miRNAs such as hsa-miR223 and has been implicated in the regulation of genes involved in PCOS development [PMC7497355] [PMC8350636].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGUGUCUGGGCGGACAGCUGCAGGAAAGGGAAGACCAAGGCUUGCUGUCUGUCCAGUCUGCCACCCUACCCUGUCUGUUCUUGCCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications