Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4503 URS000075A348_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4503: Hsa-mir-4503 is a microRNA that regulates the gene MYCN [PMC8687781]. In a study, the DEM-hub gene network was analyzed, and it was found that hsa-mir-4503, along with hsa-miR-3591-5p, hsa-miR-548as-3p, and hsa-miR-206, primarily marked the prior hub genes [PMC8687781]. Among all the differentially expressed microRNAs (DEMs), six of them (hsa-miR-548as-3p, hsa-mir-4503, hsa-miR-5194, hsa-miR-3591-5p, hsa-miR206 and hsa-miR3127) consistently changed in both datasets [PMC8687781]. These six DEMs were further analyzed in subsequent analyses [PMC8687781]. Additionally, it was found that nine modified genes were regulated by the microRNAs: hsa-mir4503, hsa-miR3591–5p ,hsa–miR548as–3p ,hsa–mi R206 [PMC8687781]. The PolymiRTS algorithm predicted that a CG nucleotide transition could influence the putative binding site of hsa mir 4503 [PMC3507747]. References: [PMC8687781] - Liang Y., Li Y., Li Z., et al. (2020) Identification of key microRNAs and genes in hepatocellular carcinoma by bioinformatics analysis. Journal of Cancer Research and Therapeutics 16(6): 1394–1400. doi: 10.4103/jcrt.JCRT_100_20. [PMC3507747] - Bhattacharya A., Ziebarth J.D., Cui Y. (2014) PolymiRTS Database 3.0: linking polymorphisms in microRNA target sites with human diseases and complex traits. Nucleic Acids Research 42(Database issue): D86–D91. doi: 10.1093/nar/gkt1021.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUAAGCAGGAAAUAGAAUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications