Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5696 URS000075A304_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5696: Hsa-mir-5696 is a miRNA that shows continuously decreasing expression according to the order of colorectal cancer (CRC) progression [PMC9304430]. Hsa-mir-5696 is not detected in peripheral blood mononuclear cells (PBMCs) from patients with systemic lupus erythematosus (SLE) [PMC6713423]. Hsa-mir-5696 has been identified as a putative miRNA target for hsa_circ_006837, a circular RNA [PMC6713423]. The functions of hsa-mir-5696 have not been described previously [PMC6713423]. Hsa-mir-5696 has been found to target the EPOR gene in three databases [PMC8963997].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAUUUAAGUAGUCUGAUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications