Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4511 precursor URS000075A281_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4511: Hsa-mir-4511 is a microRNA that has been studied in various contexts. In a study, it was found that hsa-mir-4511 had increased levels compared to other microRNAs [PMC8199419]. Another study identified hsa-mir-4511 as one of the three muscle-related microRNAs in a miRNA-mRNA network [PMC8325595]. Hsa-mir-4511 was also found to target TLR1, a gene involved in the immune response [PMC9526608]. In patients with class IV lupus nephritis, hsa-mir-4511 was found to be increased in peripheral blood [PMC9618628]. Additionally, a variant called rs34089864 was found to affect the binding sites of hsa-mir-4511 and create new binding sites for other microRNAs [PMC5842303]. Overall, hsa-mir-4511 is one of the 24 novel differentially abundant microRNAs identified in patients with class IV lupus nephritis and has potential as a diagnostic biomarker for this condition [PMC5685598].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAAAAAGGGAAAGAAGAACUGUUGCAUUUGCCCUGCACUCAGUUUGCACAGGGUAAAUGCAAUAGUUCUUCUUUCCCUUUUUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications