Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-6368 URS000075A27A_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-6368: Mmu-mir-6368 is a dysregulated miRNA that has been identified in several studies. It has been found to be one of the top rated miRNAs in terms of degree and ranking, indicating its potential regulatory effects in the network [PMC6247691]. Mmu-mir-6368, along with mmu-miR-6931-5p and mmu-miR-3547-5p, has been shown to contribute to cell differentiation, migration, and angiogenesis [PMC6247691]. Additionally, mmu-mir-6368 is one of the dysregulated miRNAs that target genes related to the PI3K/Akt signal pathway [PMC6247691]. It is also directly correlated with angiogenesis and is involved in a large number of GO annotations [PMC6247691]. In another study, mmu-mir-6368 was identified as one of the candidate miRNAs targeting Tmco5 mRNA [PMC6687282]. Overall, these findings suggest that mmu-mir-6368 plays a significant role in various biological processes and may have potential implications in disease development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGGAAGCAGUGGAGGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications