v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) USP30 antisense RNA 1 (USP30-AS1) URS000075A227_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

USP30-AS1: USP30-AS1 is a long non-coding RNA (lncRNA) that functions as an endogenous sponge for miR-299-3p in cervical cancer [PMC8114562]. In a study involving patients with cervical cancer, the expression of USP30-AS1 was classified into two groups: USP30-AS1-high and USP30-AS1-low [PMC8114562]. The study also found that USP30-AS1 was positively associated with CD8+ T cell infiltration, which is relevant to CD8+ T cell markers [PMC9036385]. Another analysis showed that the expression of USP30-AS1 was gradually reduced with increasing risk scores in a different context [PMC8184426]. Additionally, mechanistic studies revealed that ASH2L was pulled down by the full length of USP30-AS1, but not by the antisense of USP30-AS1 [PMC8732929].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUUGGUCACAGUGAGUGAAGGAACAUGGCUCUGAAUCAUGCCUGUCUGUCUCCCCAGGUCUGUGCUUAAAACCACGAAGUUCAAGAUGGAAACUGAAGGGAAGAGUGUCAAGGGGAUGGGAGAGAGGACUUGUCCAUGACUUUGGCAGCAUAAGGAAAAAAUACCCAGGGACAAGUGGCGACUUUGGAAACUCCAUUCCUCUGCAAAAUGACAUCACGAGGAGAGUGGUGGGGCCUGCGGAUGAAAAGAUCUGGCUUCUCCUCCCAACUCUGCUAUGAGGAAGCGCUGGAUGGCCCUGUCGGCCGCGGUCAUCGCCGCCUCGGCCCGGGAGCUCAGCAUUGCAGCCGCACCGGAGGCCUGAAACCGUCUCCUCCGCUACCGCCGCCGCCGCCGCCGGACCGAGGGAUACGACGGUUCCCGAGACAGCGGAACCUGCGGCCGCAGUCCCAGCACCUCGGGGGAACGUAGACCGCAGGACAGCUCCCAGGGGGACCGGAAGUAGCUGCCCCCGGAGAGCAAUAGCUGACGGACCACGUCCUUUCUUUCUUUUCCCUUAGCAACAGGCCCCGGCGUCGGUUGCUACGCUGGGCUCAGUUGCCUGGGGCUGCUUGGUUUUCAGAUUUGCUUAGGCUCCAUUCAUAAAUACAGAUGGCACACUUCUAGGAUGGACCCUGGGUCAUGAUUUGAAUUUUUCGAUGUGGGGAAGGGAGGCCAACAGCCGAAAGUCGGGUCAGGCCUCUGCUAUAAUUAGUUAUUAUUGUGGCCAGAGUGGAAAUAGGUCGCAGAGGAAGGAACUUUAAUGAGCAUGAGGCCCAUCUCUGACGAUAUCAGUAGAGAAAUCAACGUCUUUAAUAGCCAACAAACUUAUUGUUUACUUGGGUGCCAGGUAUAGAGCUAAGUAUGUUACAUUCAUUAUUUACAUUUAAUAUUCACACCAACUCUAACAUUACCCACAUUUUACAUCCCAGGGAACCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications