Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6886 precursor URS000075A1D9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR6886: MIR6886 is a little-studied microRNA with no known vascular-associated function [PMC8553949]. It was found to be upregulated in dysfunctional aortic smooth muscle cells (AoSMCs) induced by cytokines, suggesting a potential role in smooth muscle cell (SMC) and endothelial cell (EC) dysfunction [PMC8553949]. Among SMC-produced microRNAs, miR548ai showed the most significant upregulation compared to miR544A, miR4719, and MIR6886, particularly in the presence of platelet-derived growth factor (PDGF) stimulation [PMC8553949]. Other microRNAs common in the four profiles included miR544A, miR4719, MIR6886 (upregulated), and miR302F, miR579, temire, miR1200, miR548H5, and miR4284 (downregulated) [PMC8553949]. In-silico investigation of the human genome predicted that MIR6886 is located within intron 9 and contains the rs1003723 single nucleotide polymorphism (SNP) within its loop structure [PMC5841003]. Further studies are needed to determine the frequency of rs1003723 SNP in the normal Iranian population compared to individuals with familial hypercholesterolemia and its effects on MIR6886 function [PMC5841003]. Elucidating the role of MIR6886 in regulating total cholesterol concentration in blood may provide insights into susceptibility to bile duct cancer and shed light on noncoding RNA's effects on LDL levels and related diseases [PMC5841003]. The expression of MIR6886 was not found in The Cancer Genome Atlas expression matrix [PMC9792463].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGGCCCGCAGGUGAGAUGAGGGCUCCUGGCGCUGAUGCCCUUCUCUCCUCCUGCCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications