Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4535 precursor URS000075A1C3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4535: The expression of hsa-mir-4535 was found to be elevated in UVB-irradiated skin but significantly suppressed in galangin-treated skin [PMC8714160]. H2O2 was found to enhance hsa-mir-4535 expression and suppress Smad4 RNA expression in HS68 cells [PMC8714160]. The future study will focus on the transcriptional regulation of p53 in the hsa-mir-4535 promoter [PMC8714160]. Galangin was found to restore UVB-induced decrease in collagen formation by repressing hsa-mir-4535 levels and promoting Smad4 signaling in HS68 cells [PMC8714160]. Suppression of hsa-mir-4535 partially restored H2O2-induced collagen impairment in HS68 cells [PMC8714160]. Overexpression of hsa-mir-4535 or inhibition of Smad4 resulted in reduced collagen synthesis under galangin treatment following H2O2 exposure [PMC8714160]. Galangin was found to inhibit hsa-mir-4535 and activate the Smad2/3/4 complex, enhancing collagen synthesis [PMC8714160]. A putative conserved target site for hsa-mir-4535 was predicted on the Smad4 3'-UTR [PMC8714160]. Galangin treatment reversed the trend of hsa-mir-4535 and Smad4 expression, indicating regulation of Smad signaling may be involved in galangin-mediated alleviation of H2O2-induced cell damage [PMC8714160]. Galangin attenuated UVB-induced collagen breakdown by downregulating hsa-mir-4535 targeting Smad4, as shown by qPCR analysis [PMC8714160].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUGGGUCCCAGUCUUCACAGUUGGUUUCUGACACGUGGACCUGGCUGGGACGAUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications