Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5003-3p URS000075A132_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5003: Hsa-mir-5003 is one of the five miRNAs that were screened and used to develop a miRNA prognostic model [PMC5912208]. While the function of hsa-mir-139 as a tumor suppressor in various types of cancer has been extensively studied, there is a lack of relevant reports on the function of hsa-mir-5003 in cell proliferation and migration [PMC5912208]. The risk score formula for the prognostic model includes the expression levels of hsa-mir-139, hsa-mir-101-2, hsa-mir-105-2, hsa-mir-9-3, and hsa-mir-5003 [PMC5912208]. These five miRNAs were used to construct a prognostic signature based on their expression levels [PMC5912208]. Functional assessment of the target genes for hsa-mir-139 and hsa-mir-5003 suggests that these genes are significantly involved in regulating cell-based biological processes such as cell proliferation and migration [PMC5912208]. However, only the target genes for hsa-mir-139 and hsa-mir-5003 were used for further enrichment analysis due to unavailability of target gene information for other miRNAs in the Targetscan database [PMC5912208].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUUUUCUAGGUUGUUGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications