Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4301 precursor URS000075A09B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4301: MIR4301 is a 65 base-pair long non-coding RNA located on chromosome 11 within the DRD2 intronic region. It shares the same set of associated SNPs as the DRD2 gene [PMC3772989]. In a study on sickle cell disease (SCD) cohorts, a gene-based test identified MIR4301 as a suggestive signal of non-coding RNA [PMC3772989]. Additionally, MIR4301 was predicted to bind to the 3' UTR region of the DRD2 transcript [PMC3772989]. The tissue-selective expression ranking and p value ranking in physically close genes led to DRD2 and MIR4301 being identified as significant genes, respectively [PMC6836538]. The study also suggested that MIR4301 may be involved in regulating systolic blood pressure (SBP) in SCD cohorts through its binding to DRD2 [PMC3772989]. MIR4301 was found to be the most significant gene with a p-value of 5.2x10-5 [PMC3772989]. In addition to MIR4301, other miRNA genes located on chromosome 11q include miR-125b-1, let-7a, and miR-100. However, their functions are currently unknown [PMC5492892].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAGCCACCUCCCACUACUUCACUUGUGAACAUUGCAUUCGUGGAGGGUGGCAGGUGCAGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications