Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-1894 precursor URS000075A02F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1894: Mmu-mir-1894 is a recently discovered mouse microRNA that has been found to have a potential role in tumor metastasis inhibition in breast cancer cells [PMC4849059]. In a study using mouse models, it was determined that knockdown of the target gene Trim46, which is regulated by mmu-mir-1894, was sufficient to replicate the effect of mmu-mir-1894 on breast cancer metastasis [PMC4849059]. Additionally, Trim46 was found to be involved in the proliferation and migration of human breast cancer cells [PMC4849059]. Mmu-mir-1894-3p, a mature miRNA derived from the 3'-strand of mmu-mir-1894 precursor, was identified as a tumor suppressor [PMC4849059]. Mmu-mir-1894 is located close to common sites of retroviral integrations and may have a role in cell homeostasis that requires further experimental verification [PMC4849059]. Mmu-mir-1894-3p and mmu-mir-1894-5p target different sets of genes due to their different seed sequences [PMC4849059]. Although mmu-mir-1894 has been recently discovered, its function is still poorly understood [PMC4849059]. In the study, it was found that mmu-miR-449a and mmu-miR-1894 significantly decreased lung metastasis nodules formation in mice compared to control groups [PMC4849059]. Furthermore, three microRNAs including mmu-miR449a and two others had significant effects on lung metastasis in cancer cells [PMC4849059]. The functional mature form of mmu-miR 1894 against cell proliferation and metastasis was identified as mmu mir 19894 3p[PMCID: PMC4849059]. Mmu-mir-1894 was also found to inhibit metastasis and proliferation of mouse breast cancer cells [PMC4849059].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUUGUUCUCUCUCCCCUACCACCUGCCUCUUCCCUGCUGUGGAGCAGGCAAGGGAGAGGGUGAAGGGAGGGCCAGCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications