Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-650 URS000075A00C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-650: Hsa-mir-650 is a microRNA that plays a role in promoting the inflammation-induced apoptosis of intestinal epithelioid cells (IECs) by targeting NLRP6 [PMC8602894]. The primer sequences for PCR analysis of hsa-mir-650 are as follows: miR-650 forward, 5′-AGAGGAGGCAGCGCTCT-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′ [PMC7509765]. The mature sequence of hsa-mir-650 is 5′-AGGAGGCAGCGCUCUCAGGAC-3′ [PMC7509765]. Hsa-mir-650 is a microRNA that has been implicated in the regulation of various cellular processes. In the context provided, it has been shown to promote inflammation-induced apoptosis of intestinal epithelioid cells (IECs) by targeting NLRP6, a protein involved in the regulation of inflammation and cell death [PMC8602894]. This suggests that hsa-mir-650 may play a role in modulating the inflammatory response and cell survival in the intestine. To study hsa-mir-650, PCR analysis was performed using specific primer sequences. The forward primer sequence for miR-650 was 5′ - AGAGGAGGCAGCGCTCT - 3′ and the reverse primer sequence was 5′ - CAGTGCGTGTCGTGG AGT - 3' [PMC7509765]. These primers were designed to specifically amplify hsa-mir-650 during PCR analysis. The mature sequence of hsa-mir-650 was determined to be 5' - AGG AGGC AGC GCUCUC AGGAC - 3' [PMC7509765]. This mature sequence represents the functional form of hsa-mir-650 and is important for its regulatory activity. In conclusion, hsa-mir-650 is a microRNA that promotes inflammation-induced apoptosis of intestinal epithelioid cells by targeting NLRP6. PCR analysis using specific primer sequences and the determination of the mature sequence of hsa-mir-650 provide important tools for studying its function and regulatory mechanisms [PMC8602894] [PMC7509765].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAGGCAGCGCUCUCAGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta mml-miR-650a
  2. Pan troglodytes ptr-miR-650
Publications