v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TRPM2 antisense RNA (TRPM2-AS) URS0000759FE8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TRPM2-AS: TRPM2-AS is a long non-coding RNA (lncRNA) that has been implicated in various cancers, including non-small cell lung cancer, hepatocellular carcinoma, prostate cancer, bladder cancer, retinoblastoma (RB), and gastric cancer [PMC7993682] [PMC7661873] [PMC9578789] [PMC8112210] [PMC9117703] [PMC9958441] [PMC9988759] [PMC7052141]. It has been described as an oncogene and a potential biomarker and therapeutic target for these cancers [PMC7661873]. TRPM2-AS has been shown to promote cisplatin resistance in non-small cell lung cancer cells when knocked down [PMC7993682]. It has also been implicated in bladder cancer progression through its interaction with miR-22-3p and GINS2 [PMC9578789]. In retinoblastoma, TRPM2-AS acts as an oncogenic lncRNA through the miR-497/WEE1 axis and may be a more effective therapeutic target than WEE1 itself due to its regulation of miR-497 expression and its association with vascular endothelial growth factor A expression [PMC8112210]. In gastric cancer, TRPM2-AS enhances radioresistance via the miR-612/FOXM1 axis and promotes cell proliferation, metastasis, and radioresistance by functioning as a competing endogenous RNA for the tumor suppressor miR-612[ PMC9117703][ PMC7052141]. Additionally, TRPM2-AS is one of the seven prognostic NRLncRNAs in gastric adenocarcinoma[ PMC9988759]. The binding sites between TRPM2-AS and miR-138-5p have been predicted using starBase[ PMC8809918], suggesting that the miR-138-5p inhibitor can partially reverse the inhibitory effect of silencing TRPM2-AS on gastric adenocarcinoma cells [PMC8809918].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCCACCUCCCCGAGCCCAAAUGGCCAUGCAGGUCGAACACCAGCUCUGAAGUGGGCAGGGCCCCCAGGGAGGACAGCCACGGGAGCUCAGGCAGCGUCCCCGCCGGCACCUGCCUCUUUGUGCAGCGGCAGUCAGGGCCCUCGGCAAUGAGCUGAACUCGCAGUGCGGUUACGAGGGCAAAUAUGCUCCUUGAGGGCCGGCGAAACUCAGCAGCCCGAGGAAGGCUACUGAUGUGCAUUUCAUAGCCGGCUGCGAAUUUAGGAAAACAGACUUUGCUUCUCGUCACUCAGCCUACGUGACCAGGUUCAGACACAGUCUGCAGCCGCCCGCCUCGCACCCCCACUCUGCAGUGCGGUAUGUGGGGAGCUCAGGGCACAGCAGGCCAGGCCUCCCCGUGGACGUCCAGGAACCAGAACCAAACUGCCCAGGGCCCCAGAGGGGAAGAUGUCUCAGCAGACGGACAGCCGAGGCUCACAUGGCAAGCUCUGGCAGCCUGUCGGUCCCAGGAGAGAGGGGGAGAUGGCAGACGGGAAAAGAAGCCACCUGCUGGGAUGCUGAGACUCGCUUGCAGGAGCUUUUGGAACUGGCUGAGGUCACAGCUGGAACCACUGUGGCCAGCUGGAGUCUGCACAGCCCGAGUUUCCACCCCAGGGUCCCAGUAACUCCGCCCAAAUGUGCACACGAGACCUAUGAGGAGACAUAACUUUCCAGAACCCCCUUUUCUUCCACCAGCCACUUACUCAUCCAAGAACCCACCCCCGAACCUUCCCUAAUAGAAACACUGCAUUAAAGCCAGCGCGGGGAGACAGACGUGAACUGCGCCCCUGUCUCCUUGUGGGUUGGCCUAGAAUAAAAGCUUUUCUUUUCUCAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications