Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-892b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-892b precursor URS0000759FDD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-892b: Hsa-mir-892b is a microRNA that has been identified in various studies. It has been shown to be involved in neuro-inflammatory pathways and microglial activity, as indicated by changes in neuro-inflammatory markers such as Interleukins, TNF, IFN-gamma, NFkB, and markers for Th1 and Th2 lymphocyte proliferation [PMC2817457] [PMC9781133]. Hsa-mir-892b has also been predicted to interact with other miRNAs such as miR-138-5p, miR-30c-1-3p, miR-571, and miR-328-3p [PMC5610031]. In different studies, hsa-mir-892b has been found to be upregulated or downregulated in various conditions. It was found to be upregulated in pancreatic cancer [PMC9248787] and downregulated in ovarian tissue [PMC5223123]. Hsa-mir-892b has also been shown to regulate the expression of target genes such as Esrrg at the post-transcriptional level [PMC3325285]. Overall, hsa-mir-892b is a versatile microRNA that plays a role in various biological processes and is implicated in different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAAUGCCCUACUCAGAAAGGUGCCAUUUAUGUAGAUUUUAUGUCACUGGCUCCUUUCUGGGUAGAGCAAGGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications