Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-190a precursor URS0000759F9E_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-190: Mmu-mir-190 is a microRNA that was found to be significantly downregulated in the corneal endothelium of old mice compared to young mice [PMC3742134]. The expression of mmu-mir-190 was decreased by 37.1±2.78-fold in old mice [PMC3742134]. The miRNA-mRNA regulatory network analysis revealed that mmu-mir-190 is associated with brain-derived neurotrophic factor (BDNF) [PMC3742134]. In addition to mmu-mir-190, several other miRNAs were also found to be downregulated in the corneal endothelium of old mice, including mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, and mmu-miR-194 [PMC3742134]. On the other hand, miRNAs such as mmu-miR-34c and mmu-miR124 were significantly upregulated in old mice compared to young mice [PMC3742134]. The downregulation of these miRNAs suggests a potential role in age-related changes in the corneal endothelium. To validate the results from the miRNA microarray analysis, qRT-PCR was performed for several miRNAs including mmu mir 190 using the same extracted total RNA as the microarray analysis [PMC3742134]. The qRT PCR results confirmed the downregulation of these miRNAs in old mice compared to young mice [PMC3742134]. Overall, these findings suggest that changes in expression levels of specific miRNAs including Mmu mir 190 may contribute to age-related alterations in corneal endothelial function [PMC3742134].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAGCAUAUUCCUACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications