Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3976 precursor URS0000759F9C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3976: Hsa-mir-3976 is an unknown family miRNA that has been found to be significantly enriched with target genes in various studies [PMC6604454] [PMC9000903] [PMC5887684]. It has been identified as one of the miRNAs that are down-regulated in samples from Autism Spectrum Disorder (ASD) [PMC9000903]. Additionally, hsa-mir-3976 has been found to be differentially expressed in Bone Marrow Stromal Cells (BMSCs) from patients with Steroid-Induced Osteonecrosis of the Femoral Head (SONFH) compared to patients with Femoral Neck Fracture (FNF) [PMC5887684]. It has also been implicated in breast cancer metastasis and tumor growth [PMC5628841]. Furthermore, hsa-mir-3976 has been shown to have binding affinity with the BLM mRNA, and polymorphisms at specific loci can abolish this binding affinity, resulting in higher expression of the BLM protein [PMC7378827]. The expression levels of hsa-mir-3976 have also been found to be significantly up-regulated in severe patients compared to non-severe patients [PMC8890551]. Additionally, hsa-mir-3976 has been identified as a potential biomarker for Cryptosporidium parvum infection and is involved in apoptotic processes and immune responses during infection [PMC6332841]. Finally, hsa-mir-3976 is one of the miRNAs listed as candidate biomarkers for peripheral serum analysis [PMC6493311]. References: [PMC6604454] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6604454/ [PMC9000903] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9000903/ [PMC5887684] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5887684/ [PMC5628841] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5628841/ [PMC7378827] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378827/ [PMC8890551] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8890551/ [PMC6332841] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6332841/ [PMC6493311] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6493311/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGGAUAUAGAGAGCAGGAAGAUUAAUGUCAUAUUGGAGUUGGACUGCAGGGCUUCCUUUACACAAUAAAUAUUGUAUGAAGUGCUGAUGUAACCUUUACUGCAGCAUGACAUGGGAUUUGGCUGUUUUUAUGGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications