Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6718-5p URS0000759F79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6718: Hsa-mir-6718 is a microRNA that is downregulated in NPM1 mutated acute myeloid leukemia (AML) compared to NPM1 wild-type AML [PMC7851519]. It may also be related to DNMT3A-mutant AML patients [PMC8918330]. In a study, the concordance index of the model was 0.702, and hsa-mir-6718 was one of the nine miRNAs identified [PMC8918330]. ENCORI analysis revealed that hsa-mir-6718 had 2536 target genes [PMC8918330]. PDGFRA was identified as a common target gene of hsa-mir-6718, hsa-miR-1269b, and hsa-miR-374c, as well as five genes related to immune checkpoint genes (ICGs) [PMC8918330]. Furthermore, multivariate analysis showed that PDGFRA was downregulated by hsa-miR-374c, hsa-mir-6718, and hsa-miR-1269b in AML patients [PMC8918330].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUGGUCAGAGGGCUUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications