Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-890 URS0000759F06_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-890: Hsa-mir-890 is a microRNA that belongs to a cluster of miRNAs including hsa-mir-888, hsa-mir-892a, hsa-mir-892b, and hsa-mir-891a [PMC3563971]. In a study, transfection with hsa-miR-142-3p and hsa-mir-890 resulted in the absence of Occludin staining at cell junction locations while ZO-1 remained intact [PMC6174781]. These three miRNAs (hsa-miR-142-3p, hsa-miR-18b, and hsa-mir-890) may serve as indicators of functional modifications in the epithelial barrier in MetS-related fatty liver disease [PMC6174781]. Another study expressed the MetS-related miRNA trio (hsa-miR142, hsa-miR18b, and hsa-mir890) in cultured epithelial cells to investigate their impact on epithelial barriers and cell junctions [PMC6174781]. Hsa-mir890 was added to a pathway based on global miRNA profiling using Pathway Designer (IPA) [PMC6174781]. Hsa mir890 is also found in the primate X chromosome cluster of clade-specific miRNAs (hsa mir5143) [PMC3012074]. In cirrhotic livers, it was found that HSA mir890 was downregulated after TGF-beta1 treatment [PMC8351572]. HSA mir890 was also found to target GAP43 along with HSA mir3125 [PMC9837191]. Additionally, it was predicted that HSA mir890 interacts with ANXA2 mRNA using miRWalk analysis along with other miRNAs such as HSA mir206 and HSA mir155 among others [PMC5950137]. HSA mir890 is also co-deleted with SLITRK2 in a group of microRNA genes [PMC2937017]. Furthermore, HSA mir890 has been associated with mutations in inherited retinal dystrophy [PMC7648123]. Finally, HSA mir890 has been found to be overmutated in lung adenocarcinoma [PMC7648123].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUUGGAAAGGCAUCAGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-890
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-890
Publications