Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DLX6 antisense RNA 1 (DLX6-AS1) URS0000759F04_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DLX6-AS1: DLX6-AS1 is an exosome long non-coding RNA (lncRNA) that has been found to be elevated in cervical cancer (CC) patients compared to patients with cervical intraepithelial neoplasia (CIN) and healthy donors [PMC9198352]. It has been shown to enhance cell proliferation and invasion in pancreatic cancer by regulating miR-181b [PMC7453500]. DLX6-AS1 methylation has been evaluated in colorectal cancer (CRC) patients, and its influence on survival has been assessed using data from the TCGA database [PMC8811200]. DLX6-AS1 may also play a role in alleviating myocardial ischemia-reperfusion injury by regulating the miR-204-5p/FBXW7 axis [PMC9845044]. It is part of the neuronal lineage-related genes involved in NPC2-like state, primarily found in interneurons [PMC9744747]. DLX6-AS1 expression is lower in normal tissues and human bladder epithelium cells [PMC7485696]. Overexpression of DLX6-AS1 has been shown to upregulate β-catenin, c-myc, and cyclin D1, while downregulating GSK-3β [PMC6880345]. It is highly expressed in exosomes from hepatocellular carcinoma (HCC) cells and promotes HCC cell proliferation, migration, invasion, angiogenesis, and M2 macrophage polarization [PMC7485696] [PMC9744747] [PMC6880345] [PM9845044] . DLX6-AS1 expression is also associated with non-small cell lung carcinoma (NSCLC), squamous cell lung carcinoma, smoking history, primary tumor size, tumor clinical stage, metastasis status, poor survival outcomes of pancreatic cancer patients. It has been shown to regulate ANXA10 expression, accelerate hepatocellular carcinoma development, and interact with miR-513c/Cul4A axis [PMC6914966] [PMC6510228] [PMC9845044]. DLX6-AS1 functions as a sponge for miR-16-5p in NSCLC cells [PMC8799293].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUUCACACCUGGAUGUGCUCACUCAACCAAGAAUAUAGAGAAAGAGCUUCUGCCCUGAGACUCAGAAAAAUAUUCUCCUGUGCUUUGGUUCAGUAUAGAUUUCUAAACCCUGAUCAUUGCUUAAGAGAUAUUCACUGAGGACAGAGUCUUGCUCUAUUGCCCAGGCUGCAACUGGUGUGAUCUCGGCUCACUACAACCUCUGCCUCCUGGGUUCAAGCGAUUCUCCUGCCUCAAGCUCCCAAGUAGCUGGGAUUACAAGCAUGCACCACCAUGCCUGGCUAAUUUUUGUAUUUUUAGUGGAGACGGGGUUUCGCCACAUUGGCCAGGGUGGUCUUGAACUCCUGACCUCAAGUGAUCCACCUGCCUUGGCCUCCCAAAGUGCUGGGAUUAUAAGCAUGAGCCACUGCACCCAGCCUUAUACUGAACUUUCAAUGGGUUCAAUUCCACUAGGAGCAUAAAGGCCACUGCAUAUGAGUUGUGGAAAGAAGAGAUUAGAAGAAGGAAGAACUUGAGAUGAGUUCCUCCCUUCAACAUUCUGUCUCCUCCUACCUAGCAUCUUCUUUCUUUUAGUCUUUCUAGAAUGUCCAUCUGUUUUUGGCCAUUGCGGAGAGAGAAGCUGAGCUUUAAAGGAGUAGGAGCUUCAAAGGCGUAGGAGCUUCAAAAUUCUUGUUUCUUCAUGUUUGAUCACCCUUCUAAACCUGUCUUCUGUUCCUUCUGCUAUUCUUUUUUCUUAGAGCAUAGGAAAGGGGAGCUUUUAAAUUAAUACUUAAAGCAUGGAAAAAAAGAACUUGAGAAGAAAGUAAAACAAGGGAGAUGAGGCUAGUAAAGUAAGGAAAAUGAAGAGGAAGAGGAGGAAGGGUUAGCUUCUAAAUUCCAAGUCAAAUUGAUAUGGAACAGGCAAGCCGCUUGUCUUACUUAAACUUCAGAAAAGGAUCUGCUGAAACUUGAUAGAAAUGGAAAGGGAAAUCCUUGGGGUGGGGAACCUCCAAACAUUAGUAAUGAUAUUGAACAACUCAAAGUAUUGAGGAAAUCUGCAGGCUACAUGCCUGAAGAUUACCCAUGCAGAUAGACCAAAAGGAUUAGAAUUAUCUGUUGAUAUUAGUAAUAUUUAUUGACAUCUAGCUAGUAUUGGUAAUUUUAAGUUUUAGAUUAAUUUCUUUGGUAAUAGCUAUGAUAUAUUUUAUAGACAAGAAUUAUAUCUAUAGGCUUGCUAUCAUAGGCUCUUUUAAUCAGCAUUAAUUUAGUCUACUGAUUUUUAGCACAUUUGAAUCAUUCACUUAUGCUAGGUAACUCAUUGCAAAAUAAAAAGAUGAUUCCUGUAUGUAUGGCAGCUAUACAUUAAGGAGGAGUCUACCAGAAUAUGAAAAAGUCAGCUGACCUAAAUAUUGCUGAGACAAAGGAAAACCCACUCCCUUGGAGGAGCAUGACCUUUUCCUGUAAUUCUUCCCACUGCUGUUGUUGAGCUCCUUGGAUCCUGGCUCCUGGACACCAUCAUCAAGAAGACUUUAUGGAUGGGCUGUCCACCCACUGAGAGAAGAGGAGCAUCAGCUACAGUUUCUCUCUAGAUUGCCUUCUUCAUUUUGAGUAAUGACUGUCAGCAGGGUCAGAUUAAACACAAAACAACUGGACAAUUGCUUGGAGGACUAAACUAUAAGGGCACUAACAUGUCAAUAGUAGGCUAACACAUCCAUGGAAAAUAUAUUUACCAGCUCUUCUCUCAGGGAGGAUUCUGUGUGGGGUUGGAAGUAAUGAUUUGUUAAAUUCCUUAGGGGUAGAAAGUAGGGCAUAAUCAGAAUAUAGAGGAAUAUGCUGUUUGACUUCAGGGUUUCUGUUUUUCUUACUAGGAUAUAUAAAACAGGGACUCUAGCUAGAUUGUUUAUGACCACAGAGGGUAGGCUGAGUGCUCCCAUGAUCUUCCUGCUUGGUUCUUGCCCAUACAGAGGUCAGCCUUUCCUCUAAUAAAGAUUGAACAAGUAGUGGUCUGAGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications