Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-8071 precursor (hsa-mir-8071-1, hsa-mir-8071-2) URS0000759EF1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-8071: Hsa-mir-8071 is a microRNA (miRNA) that has been identified in various studies [PMC7607069] [PMC7062941] [PMC7680973] [PMC7719707] [PMC7824949] [PMC7220275] [PMC5048719] [PMC6599129]. It has been found to be co-targeted with other miRNAs, such as hsa-miR-17-5p, hsa-miR-5196-3p, and hsa-miR-18a-5p, among others [PMC7607069]. The H19 rs217727 G>A SNP has been shown to affect miRNA-lncRNA interactions and result in the formation of hsa-mir-8071 and hsa-miR-4804–5p, while destroying the binding sites of hsa-miR-3960 and hsa-mir-8071 on H19 [PMC7062941]. Hsa-mir-8071 has been found to have predictive value in identifying patients with mesial temporal lobe epilepsy (mTLE) with hippocampal sclerosis (HS) compared to healthy controls, with a sensitivity of 83.33% and specificity of 96.67% [PMC7680973]. It has also been identified as being upregulated in exosomes in the culture medium of both UVA and UVB groups, along with other miRNAs such as hsa-miR-769–5p and hsa-miR–758–3p among others[ PMC7719707]. Additionally, it has been found to be associated with various diseases such as aortic aneurysm dissection (AAAD) where it is upregulated compared to normal aortic tissues[ PMC6599129]. The rs217727 polymorphism has been linked to the levels of hsa-mir-8071 in the circulation [PMC8666442]. Overall, hsa-mir-8071 has been implicated in various biological processes and disease conditions, highlighting its potential as a biomarker and therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGCCACAUGGCCCAGGCUCUUCUCCGAGUGAUCUCGGUGGACUGGAGUGGGUGGUAGGUGGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications