Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-372-3p URS0000759ECA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-372: Hsa-mir-372 is a microRNA that has been found to play a role in various biological processes and diseases [PMC6892182]. It has been identified as an independent prognostic factor in ceRNA networks, interacting with multiple genes and miRNAs [PMC7249743]. Hsa-mir-372 has also been implicated in the development of hepatocellular carcinoma [PMC7271455]. In the MAPK pathway, LINC01010 has been shown to potentially inhibit the function of hsa-mir-372 [PMC8487518]. Hsa-mir-372, along with hsa-mir-20 and hsa-mir-10b, have been identified as having high degrees of interaction with real hub genes [PMC8739919]. High expression of hsa-mir-372 has been associated with poor prognosis in certain diseases [PMC5461634]. Hsa-miR-519a, hsa-miR-517a, and other miRNAs that target apoptosis-related genes have been implicated in the regulation of p53-signaling and apoptosis in recurrent miscarriage [PMC4829624]. Hsa-miR-191 has been detected abundantly in medium containing aneuploid embryos during embryonal development [PMC9425991]. In periodontitis tissue, hsa-mir-372 was found to be downregulated [PMC7606899]. The expression of hsa-miR-371,2,3 cluster members including hsa-mir-372 was also observed to be altered in certain diseases [PMC5399401].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGUGCUGCGACAUUUGAGCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Macaca mulatta mml-miR-372-3p
  2. Pan troglodytes ptr-miR-372
  3. Pongo pygmaeus (Bornean orangutan) ppy-miR-372
Publications