Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) maternally expressed 3 (MEG3) URS0000759EA9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MEG3: MEG3, a long non-coding RNA (lncRNA), has been investigated for its molecular mechanism in relation to the pathogenesis of severe pneumonia [PMC8806474]. Knocking down SON or SRRM2, and inhibiting transcription did not affect the localization of MEG3 to nuclear speckles [PMC9221825]. Treatment with pladienolide B (PLB), an inhibitor of splicing, caused MEG3 transcripts to form circular formations surrounding nuclear speckles [PMC9221825]. The relocalization of MEG3 transcripts between the nuclear speckle and the nucleus was observed during transcription and splicing inhibition [PMC9221825]. The association between MEG3 and nuclear speckles increased when transcription and splicing were inhibited [PMC9221825]. It was found that MEG3 repositioned from the periphery to the core of nuclear speckles during transcription inhibition [PMC9221825]. The association of MEG3 with nuclear speckles was observed in HepG2 and HFF-1 cells under regular conditions as well as during transcription and splicing inhibition [PMC9221825]. The association between MEG3 and nuclear speckles increased under conditions of transcription inhibition with DRB [PMC9221825]. The movement of MEG3 in relation to nuclear speckles was observed using live-cell imaging, showing partial association between them [PMC9221825]. Overexpression of MEG3 reduced invasion and migration in Cr(VI)-transformed cells, indicating its importance in these processes [PMC9421329].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCCCCUAGCGCAGACGGCGGAGAGCAGAGAGGGAGCGCGCCUUGGCUCGCUGGCCUUGGCGGCGGCUCCUCAGGAGAGCUGGGGCGCCCACGAGAGGAUCCCUCACCCGGGUCUCUCCUCAGGGAUGACAUCAUCCGUCCACCUCCUUGUCUUCAAGGACCACCUCCUCUCCAUGCUGAGCUGCUGCCAAGGGGCCUGCUGCCCAUCUACACCUCACGAGGGCACUAGGAGCACGGUUUCCUGGAUCCCACCAACAUACAAAGCAGCCACUCACUGACCCCCAGGACCAGGAUGGCAAAGGAUGAAGAGGACCGGAACUGACCAGCCAGCUGUCCCUCUUACCUAAAGACUUAAACCAAUGCCCUAGUGAGGGGGCAUUGGGCAUUAAGCCCUGACCUUUGCUAUGCUCAUACUUUGACUCUAUGAGUACUUUCCUAUAAGUCUUUGCUUGUGUUCACCUGCUAGCAAACUGGAGUGUUUCCCUCCCCAAGGGGGUGUCAGUCUUUGUCGACUGACUCUGUCAUCACCCUUAUGAUGUCCUGAAUGGAAGGAUCCCUUUGGGAAAUUCUCAGGAGGGGGACCUGGGCCAAGGGCUUGGCCAGCAUCCUGCUGGCAACUCCAAGGCCCUGGGUGGGCUUCUGGAAUGAGCAUGCUACUGAAUCACCAAAGGCACGCCCGACCUCUCUGAAGAUCUUCCUAUCCUUUUCUGGGGGAAUGGGGUCGAUGAGAGCAACCUCCUAGGGUUGUUGUGAGAAUUAAAUGAGAUAAAAGAGGCCUCAGGCAGGAUCUGGCAUAGAGGAGGUGAUCAGCAAAUGUUUGUUGAAAAGGUUUGACAGGUCAGUCCCUUCCCACCCCUCUUGCUUGUCUUACUUGUCUUAUUUAUUCUCCAACAGCACUCCAGGCAGCCCUUGUCCACGGGCUCUCCUUGCAUCAGCCAAGCUUCUUGAAAGGCCUGUCUACACUUGCUGUCUUCCUUCCUCACCUCCAAUUUCCUCUUCAACCCACUGCUUCCUGACUCGCUCUACUCCGUGGAAGCACGCUCACAAAGGCACGUGGGCCGUGGCCCGGCUGGGUCGGCUGAAGAACUGCGGAUGGAAGCUGCGGAAGAGGCCCUGAUGGGGCCCACCAUCCCGGACCCAAGUCUUCUUCCUGGCGGGCCUCUCGUCUCCUUCCUGGUUUGGGCGGAAGCCAUCACCUGGAUGCCUACGUGGGAAGGGACCUCGAAUGUGGGACCCCAGCCCCUCUCCAGCUCGAAAUCCCUCCACAGCCACGGGGACACCCUGCACCUAUUCCCACGGGACAGGCUGGACCCAGAGACUCUGGACCCGGGGCCUCCCCUUGAGUAGAGACCCGCCCUCUGACUGAUGGACGCCGCUGACCUGGGGUCAGACCCGUGGGCUGGACCCCUGCCCACCCCGCAGGAACCCUGAGGCCUAGGGGAGCUGUUGAGCCUUCAGUGUCUGCAUGUGGGAAGUGGGCUCCUUCACCUACCUCACAGGGCUGUUGUGAGGGGCGCUGUGAUGCGGUUCCAAAGCACAGGGCUUGGCGCACCCCACUGUGCUCUCAAUAAAUGUGUUUCCUGUCUUAACAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications